Uncover unique phenotypes and understand protein expression on a single-cell level with TotalSeq™ oligo-conjugated antibodies. Seamlessly integrate these reagents into existing single-cell sequencing protocols for simultaneous characterization of protein and RNA. Explore the capabilities of proteogenomic analysis and how TotalSeq™ reagents can enable highly multiplexed single-cell protein studies for novel applications in precision medicine, oncology, immunology, neuroscience, and stem cell research.

 

TotalSeq™ format antibodies are patent pending proprietary technologies of BioLegend. Contact us if you are interested in partnering with us around this technology.


TotalSeq™ Reagents for Single-Cell Protein and RNA Detection


TotalSeq™ oligo-conjugated antibodies enable measurement of proteins at a single-cell level and integrate seamlessly into existing single-cell RNA sequencing workflows, including Drop-Seq and those available from 10x Genomics.


Simultaneous Multiomic Data Generation: Increase the power of single-cell experiments by combining proteomic and transcriptomic data.

Reduced Dropouts: In contrast to mRNA, TotalSeq™-derived antibody tags are not highly prone to dropouts, which are essentially false negative readouts.
 

Ultra-High Parameter Protein Detection: Detect hundreds of proteins in a single cell.  A lower dropout rate contributes to enhanced sample clustering and the ability to better identify specific cell types.
 

Diverse applications: With a wide-range of mouse and human targets available, you can use TotalSeq™ antibodies in a variety of research areas, including:

  • Personalized or Precision Medicine
  • Cancer Research
  • Stem Cell Research
  • Basic and Applied Immunology
  • Biomarker Discovery
  • Characterization of New or Rare Cell Types
  • Neuroimmunology
  • Vaccine Research
 
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Highlighted Publications

 

Multi-Omics Resolves a Sharp Disease-State Shift between Mild and Moderate COVID-19

Su Y. et al. Cell. 2020; October. DOI: 10.1016/j.cell.2020.10.037

 

A major study aimed at performing multiomic analyses to characterize immune responses from COVID-19 patients. Using a panel of over 190 TotalSeq™ antibodies, this study identified novel immune cell populations that emerge in patients experiencing moderate COVID-19 severity that are expanded in severe cases. Additionally, the study identified changes within plasma metabolite profiles of patients experiencing severe COVID-19 disease that indicate that depletion of certain metabolites is correlated with the development of severe disease.

 

 

A Conserved Dendritic Cell Regulatory Program Limits Antitumour Immunity

Maier B, et al. Nature. 2020; doi: 10.1038/s41586-020-2134-y.

 

Immune checkpoint blockade is a recent cancer treatment method that induces a durable antitumor response. This therapy aims to mitigate the tolerogenic immune response induced by dendritic cells upon presentation of tumor antigen to T cells. However, it is only effective in a limited subset of cancer patients. This study aims to understand the mechanism by which enhancement of systemic antitumor T cell immunity occurs after neoadjuvant PD-L1 blockade. Through the use of single-cell proteogenomics, the authors identify a dendritic cell regulatory program that limits antitumor activity and is induced by expression of IL-4. Blockade of IL-4 results in increased antitumor responses, suggesting a potential treatment for the improvement of immune checkpoint therapy. 

Discover Antibody-Oligo Formats

 

Each TotalSeq™ antibody is conjugated to a unique oligonucleotide containing a capture sequence, a clone-specific barcode sequence, and a PCR handle compatible with Illumina® sequencing reagents and instruments. Barcodes are placed between the PCR handle and 3’ flanking sequence. The oligonucleotide sequence that is conjugated to our TotalSeq™ antibodies is also referred to as an Antibody-Derived Tag, or ADT. The oligo sequence that is conjugated to our hashtag reagents is referred to as a Hashtag Oligonucleotide, or HTO.

 

For single-cell protein and RNA analysis, we offer TotalSeq™-A, -B, and –C formats and continue to work with compatible partners to support new versions of genomics reagents and solutions. 

Understand the Differences Between TotalSeq™ Formats

 

TotalSeq™-A: Designed to work with any sequencing platform that relies on poly(dT) oligonucleotides as the mRNA capture method.  TotalSeq™-A antibodies contain a poly(A) sequence which mimics a natural mRNA.

 

TotalSeq™-B: Capture sequence is compatible with 10x Genomics Chromium Single Cell Expression Solution 3’ kit with Feature Barcode Technology (v3 or v3.1).

 

TotalSeq™-C: Capture sequence is compatible with the 10x Genomics Chromium Single Cell Immune Profiling Solution (5’) which allows for immune repertoire profiling of T and B cell receptors at a single-cell resolution.

10x Genomics' Solutions, compatible with TotalSeq™-B and –C  antibodies, contain all necessary reagents to process and amplify oligos derived from both TotalSeq™ reagents and mRNA. When using TotalSeq™-A reagents with the 10x Genomics' Single Cell Gene Expression Solution Kits (v2, v3, v3.1), additional reagents for preparation of libraries must be purchased. Please refer to our protocols for a complete list.

 

  TotalSeq™-A TotalSeq™-B TotalSeq™-C
10x Genomics compatibility Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing the poly(A) tail capture method Single Cell Gene Expression Solution (3’, v3 or v3.1) with Feature Barcoding Technology and 10x Genomics Data Analysis Software1 Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software1
PCR handle CCTTGGCACCCGAGAATTCCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN2 CGGAGATGTGTATAAGAGACAGNNNNNNNNNN
Capture sequence Poly-A [(A)30*A*A3] NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A4 NNNNNNNNNCCCATATAAGA*A*A4
Next-generation sequencing compatibility Compatible with Illumina instruments Compatible with Illumina instruments Compatible with Illumina instruments

 

Notes:

  1. 10x Genomics' Data Analysis Software does not support cell hashing analysis.
  2. N represents a randomly selected A, C, G, or T.
  3. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.
  4. These sequences are unique to the TotalSeq™-B and -C conjugates, and were developed independently of the reagents used by researchers at the New York Genome Center (NYGC, CITE-seq.com). TotalSeq™-B, -C, and the antibodies used by NYGC are all compatible with 10x Genomics' Solutions, but utilize different oligo sequences. As such, protocols and additional reagents, including required primers, differ between the antibody formats. Please refer to our protocols when using TotalSeq™ reagents.

Overview of the TotalSeq™ Workflow

 

 

Protocol: Using TotalSeq™ Antibodies for CITE-Seq

Using TotalSeq™ Antibodies for CITE-Seq

 

Multiplex Samples with Hashtag Antibodies

 

Hashtag Diagram

Cell Hashing

To pool multiple samples prior to loading them onto a platform capable of single-cell isolation, try one of our hashtag reagents. Each pre-mixed, ready-to-use hashtag reagent contains a pool of antibodies designed to recognize ubiquitously expressed cell surface markers and is conjugated to a unique barcode. For human samples, our hashtag reagents recognize CD298 and β2-Microglobulin, and for mouse samples, hashtag antibodies recognize CD45 and H-2 MHC Class I.

 

Benefits of using cell hashing:

  • Robust multiplet identification.
  • Minimize variability and reduce batch effects between samples.
  • Pool smaller samples to reach minimal cell numbers.

 

Read more about cell hashing and how they can be used to multiplex samples in the initial paper by Stoeckius M, et al.

Nuclei Hashing

In addition to single-cell analysis in whole and intact cells, single-nucleus analysis makes it possible to characterize cellular states and physiology in tissues that are challenging to dissociate. This includes tissues that are rich in certain cell types like neurons, adipocytes and muscle cells. Single-nucleus analysis can also help when tissue storage is required, as it is difficult to recover and obtain single-cell suspensions from archived frozen material.

 

To pool isolated nuclei from different samples, we developed nuclear hashing reagents. Our nuclear hashtag antibodies recognize a family of nuclear pore complex proteins and can cross-react with vertebrate organisms and other invertebrate species, such as Xenopus and yeast.

 

Read more about single nucleus hashing analysis in a Nature Communications paper first describing the technology by Gaublomme, et al.

 

Understand the Differences between Hashtag Formats

 

We offer hashtag reagents in our TotalSeq™-A, B, and –C formats. Hashtag reagents from all formats will function similarly, but the workflow and required primers differ.

 

For TotalSeq™-A reagents, the PCR handle between antibodies and hashtag reagents are different. In practice, this means that you will generate two separate libraries– one for your cell surface markers (referred to as ADTs) and one for hashtag-derived oligos (referred to as HTOs). This is beneficial because the two libraries can be mixed at different ratios prior to sequencing to avoid an excess of reads from the hashtags.

 

For TotalSeq™-B and –C reagents, the PCR handle is the same between both your antibodies of interest and the hashtag antibodies. In practice, this means that the hashtag and antibody libraries must be prepared together. To avoid an excess of HTO readings, we recommend titrating down the hashtag reagents. For more information on how to titrate TotalSeq™ products, read our FAQs.

 

Simplify the Proteogenomics Workflow With Antibody Cocktails

 

Remove the need for additional optimization and minimize variability between experiments using pre-defined TotalSeq™ antibody cocktails. Each single-use tube contains pre-titrated amounts of each lyophilized antibody.

 

Benefits of Using TotalSeq™ Cocktails:

  • Provided in convenient, single-use tubes
  • Pre-titrated antibodies for optimal performance
  • Offer reduced cost when compared to buying individual antibodies
  • Minimize variability between different experiments, different labs, and during longitudinal studies

Characterize Cell Diversity to an Unprecedented Level with Universal Cocktails

 

Take a deeper look at immune cells with our TotalSeq™ Human Universal Cocktails, available in TotalSeq™-A and C formats. Each cocktail contains over 125 antibodies and their associated isotype controls for large-scale protein detection. Within the cocktail, each antibody has been individually titrated using next-generation sequencing as a read-out to provide optimal discrimination of positive and negative cell populations.

 

TotalSeq™-A Universal Cocktail v1.0

 

TotalSeq™-C Universal Cocktail v1.0

 

 

TotalSeq™-A Universal Cocktail Representative Data

 

Data shown for a subset of markers in the cocktail; download the complete dataset for all 154 primary targets and 9 isotype controls.


Human PBMCs were stained with the TotalSeq™-A Human Universal Cocktail v1.0 and processed using the 10x Genomics' Chromium Single Cell Gene Expression Solution (3’) and Illumina sequencing. Protein and RNA count data were transformed and visualized in a UMAP projection overlaid with protein and RNA expression levels. Clusters were identified based on protein expression only.

 

TotalSeq™-C Universal Cocktail Representative Data

 

Data shown for a subset of markers in the cocktail; download the complete dataset for all 130 primary targets and 7 isotype controls.


Human PBMCs were stained with the TotalSeq™-C Human Universal Cocktail v1.0 and processed using the 10x Genomics' Single Cell Immune Profiling Solution (5’) and Illumina sequencing. Protein and RNA count data were transformed and visualized in a UMAP projection overlaid with protein and RNA expression levels. Clusters were identified based on protein expression only.

Identify Major Immune Cell Types with TBNK Cocktails

 

Our TBNK Panels are designed to identify T, B, and NK cells as defined by the expression of CD3, CD4, CD8, CD11c, CD14, CD16, CD19, CD45, and CD56. The TBNK cocktail is available in TotalSeq™-A, B, or C formats and is compatible with a variety of single-cell platforms.

 

Each cocktail has been optimized using human PBMCs. Using lysed whole blood or additional TotalSeq™ antibodies may require further optimizations. Please contact our technical service group for guidance.

 

Human PBMCs were stained with the TotalSeq™ Human TBNK panel containing antibodies against CD3, CD4, CD8, CD19, CD56, CD14, CD11c, CD16, and processed using the 10x Genomics' Single Cell 3’ v3 feature barcoding kit and Illumina sequencing. Protein count data were transformed and visualized in a UMAP projection overlaid with protein expression levels for each component of the cocktail. Clusters were identified based on protein expression only.

ProductsHere
Insert Note Here
Save Close Clear
Lab Timer
Tools
Login/Register
Remember me
Forgot your password? Reset Password
Request an Account